1973 Great evolutionary biologist Theodosius Dobsansky (Theodosius Dobshansky, 1900-1975) wrote an article entitled “Nothing makes sense in biology except in the light of evolution”. Of course, in biology we mean nothing without looking at the light of evolution. We will try to do this today to “make sense” of the virus Animals This affects their effectiveness Vaccines Finally in our lives.

DNA: A Global Code

If we have to choose a single argument that proves the theory of evolution (developed by a British naturalist in 1859 Charles Darwin, 1809-1882), the fact that all living things (from simple monocytes to the most complex like humans) have a common genetic code, DNA (deoxyribonucleic acid). We can describe DNA (somewhat simply) as a polymer of four nucleic acids: adenine (A), thymine (T), guanine (G), and cytosine (C). So, when we say that biologists read the sequence of a genome, we really mean a “text” of thousands or millions of characters without punctuation: ATGCTCTAACGGGATTGACAT G

But what does the genetic code contain? The genetic code is the recipe for creating an active organism, and translates the information stored in DNA into proteins and molecules that ensure the structure and proper functioning of cells.

All living organisms are composed of 20 different amino acids, and the order of the protein molecule is determined by the alphabetical order of DNA. Three consecutive letters of DNA define the identity of an amino acid. Thus the 21 letters in the DNA in our example correspond to the first 7 amino acids of a protein.

Viruses: Always with me Their host

But what does this have to do with the virus? Let us first clarify some viruses SARS-CoV-2 Including RNA viruses. RNA (ribon nucleic acid) is similar to DNA, but carries another nucleotide, urease (U), instead of thymine. However, in practice, nothing else changes in terms of coding. That is why viruses can be used to multiply our own cells.

In fact, whenever a virus controls one of our cells, it immediately transforms into a viral particle production unit. In other words, the cell, instead of producing the necessary proteins, is involved in the creation of viral proteins that make up its outer shell, as well as in the multiplication of viral genetic material. Gradually, the weakened cell dies, leaving millions of viral particles ready to infect their next target.

T

Random errors Benefits!

Mistakes made by our cells by copying DNA (viral or intimate) are called mutations. For example, if an error occurs in the 5th position in the ATGCTCTAACGGGGATTGACAT series and T is replaced by an A, we will talk about a mutation in point 5, and the range would become ATGCACTAACGGGTTGACAT. However, in addition to these point mutations, there are others that occur when large chunks of genetic material are lost or added.

The effect of an organism’s transformation varies: it is extremely simple and severe, depending on the changes it makes in proteins. In humans, single letter mutations can cause serious illness. However, viruses are not considered organisms because they cannot reproduce without the careless help of their hosts. As a result, they do not get sick when their genetic material is mutated! However, random changes in genetic material can be bad, indifferent, or viral. In the first case they cause the production of new viral particles to be removed. In the latter case they may be attributed to a virus that biologists call an evolutionary achievement.

Natural selection At work

What does this mean; He will say that they give him the ability to increase even more! From comparative studies of the genomes of different strains of the virus, scientists know that the planet was able to establish its dominance thanks to a mutation in the 614th place of the genome that occurred in China in January 2020. Mutation is the conversion of an amino acid into a protein. The spike of the virus makes it very easy to enter human cells. New mutations of the virus, both British and South African, also collected mutations critical to their transmission.

Seen from above, the transformation pressures of the virus are already not strange. In fact, it’s a time before each virus has new strains, and mutations are more likely to accumulate as a virus spreads. But it is wrong to assume that the virus will harm us: the virus mutates randomly, and some of these changes will succeed when they favor its multiplication. What we see now with the gradual domination of new executives is practically nothing more than the result of natural selection!

And possible circumstances Transmissibility

Unfortunately, scientists believe that SARS-CoV-2 will further increase its transmission. Vaccines only provide partial protection as soon as the transmission capacity passes through the spike protein that most vaccines are designed for.

Fortunately, increased transmission of the virus does not mean increased contagion, i.e. the potential for serious disease. Strictly speaking, natural selection works against increased contagion: a virus kills its victims and immediately stops its spread. It is therefore more difficult to sustain increased infectious stresses. Of course, this does not mean that we should be careless. On the contrary, it requires the vigilance and monitoring of executives spread across the population to take appropriate action at the appropriate time.

Possible circumstances

What are the possible situations from now on? Experts estimate that the virus will be more compatible with humans, a relatively new host. Adjustment will lead to increased transmissibility and reduction of infectious diseases, some of which will result in an increase in the population as a result of more people being vaccinated and the evolutionary strain infected with the virus. In other words, new strains of the virus are expected to persist, and new ones will emerge. New vaccines may be needed each year, such as leptospirosis.

How our lives will develop with the virus in the future depends on many parameters. Critical of these is the speed at which we make vaccines (we will take vaccinations!), And it is clear that measures to prevent the virus from spreading in the near future (reducing the risk of mutation accumulation) are the best defense. , Personally and demographically.

Change the genome every 11 days

Today, there are 26 million active virus cases worldwide. This means that the cells of 26 million people produce unimaginable amounts of viral particles, some of which carry mutations. In the SARS-CoV-2 genome of 29,829 characters, it is estimated that more than one letter is replaced every eleven days!

Follow it In Google News Be the first to know all the news

See all the latest news from Greece and the world